Manufacturers Trader Service OEM

Medical Biological Union LLC

16, Inzhenernaya Str. , 630090 Novosibirsk
Russian Federation

Telephone +7 383 3637714
Fax +7 383 3637718
info@mbunion.com

Trade fair hall

  • Hall 3 / K25
 Interactive Plan

Hall map

MEDICA 2016 hall map (Hall 3): stand K25

Fairground map

MEDICA 2016 fairground map: Hall 3

Our range of products

Product categories

  • 03  Diagnostics
  • 03.01  Clinical chemistry
  • 03.01.02  DNA diagnosis kits
  • 03  Diagnostics
  • 03.01  Clinical chemistry
  • 03.01.07  Gene tests / molecular biological diagnostic

Gene tests / molecular biological diagnostic

  • 03  Diagnostics
  • 03.02  Immunochemistry (Immunology)
  • 03.02.07  Immuno assay systems

Immuno assay systems

  • 03  Diagnostics
  • 03.02  Immunochemistry (Immunology)
  • 03.02.07  Immuno assay systems
  • 03.02.07.06  Enzyme immunoassay (EIA, ELISA, EMIT)

Enzyme immunoassay (EIA, ELISA, EMIT)

  • 03  Diagnostics
  • 03.03  Haematology / Histology / Cytology
  • 03.03.06  Haematology reagents
  • 03  Diagnostics
  • 03.03  Haematology / Histology / Cytology
  • 03.03.06  Haematology reagents
  • 03.03.06.02  Control material for haematology (control blood etc.)

Control material for haematology (control blood etc.)

  • 03  Diagnostics
  • 03.05  Infectious Immunology
  • 03.05.03  Equipment and systems for HIV determination units

Equipment and systems for HIV determination units

  • 03  Diagnostics
  • 03.05  Infectious Immunology
  • 03.05.04  Controls / Standards / Calibrators - Infect. immunology

Controls / Standards / Calibrators - Infect. immunology

Our products

Product category: Controls / Standards / Calibrators - Infect. immunology

Contract development and manufacture in IVD

MBU-Technology Llc is a Russian biotechnology company which has a great experience in development of diagnostic kits and raw materials for IVD. Our R&D scientific team has designed and developed numerous medical diagnostic products during the past 10 years. We have experience in all phases of IVD product development, starting from raw material development and finishing with large scale production.

MBU-Technology Llc is the expert in the following IVD directions:

Biomarkers:
HIV-1/2 antigen and antibodies,Anti-HCV antibodies, HBsAg, anti-HBsAg antibodies, TORCH infections, anti-T.pallidum antibodies, HIV-1,2 RNA, HBsAg DNA, genetics SNP markers, parasites DNA

Platforms:
Magnetic Nanoparticle,
Chemiluminescence,
Fluorescence,
ELISA,
Microfluidic Systems.
Lateral Flow,
Real-Time PCR,
Reverse Transcription PCR.

Detection Technology:
Horseradish peroxidase (HRP),
Alkaline Phosphatase,
Streptavidin-Biotin,
Quantum Dots,
Colloidal gold,
Luminol.

Technologies and methods:
Conjugation;
Lyophilization;
Protein cloning, production and purification;
Protein stabilization,
Protein immobilization.

Types of products:
Monoclonal antibody,
polyclonal antibody, 
recombinant antigens, 
conjugates with enzymes,
conjugates with fluorescent dyes and Quantum dots
conjugates with beads

ELISA kits,
Lateral-flow kits,
Real-Time PCR kits,
DNA/RNA purification kits,
CLIA kits,
Lyophilized and liquid serum controls,
Lyophilized and liquid blood controls.

Contact information:
MBU-Technology Ltd
www. mbu-tech.com
16 Inzhenernaya Str.,
Novosibirsk, 630090 Russia
Phone: +7 383 3637714
E-mail: info@mbu-tech.com

More Less

Product category: Haematology reagents

Hematology Controls and Calibrators

Hematology controls “Hematrol 5D\L” for evaluation of precision and accuracy of hematology analyzers. All of these lyophilized hematology controls and calibrators feature long-term stability.

www.mbu-tech.com

More Less

Product category: DNA diagnosis kits

Reagents for PCR

Companies Biosan and Biolabmix are manufacturers of variety reagents for PCR (enzymes, standard and modified NTP and dNTPs, DNA Ladders, MasterMixes) and Immunobiochemicals (monoclonal antibodies, affinity purified antibodies, conjugates, immunosorbents) including unique antibodies to proteins of  tick borne encephalitis virus (TBEV).

Hot Start Taq DNA Polymerase is the optimized mixture of Taq Polymerase and Anti-Taq monoclonal antibodies. Antibodies block polymerase activity during set-up of the PCR reactions at ambient temperature (20-22 °C). The inhibition of Taq DNA polymerase is completely reversed when the temperature is above 70 °C. The PCR products obtained with Hot Start Taq DNA Polymerase are free from unspecific products and from primer-dimers.

Features:

 reliable and reproducable quantification in qPCR
 perfect for real time PCR
 especially for diagnostic purposes
 reaction set-up at room temperature
 activation of enzyme during first heating
 no change or optimization of protocol necessary
 high specifity, reduced primer mismatch or dimers

Applications:

   Hot start PCR
   Real time PCR
   Amplification of complex genomic and cDNA templates
   Multiplex PCR

  High specifity PCR

Taq DNA polymerase, highly purified from bacterial DNA.   Concentrated up to 50 000 U/ml – by request.

 Purified from E.coli strain carrying plasmid with the cloned gene encoding Thermus aquaticus DNA polymerase. Taq DNA polymerase catalyses 5’→3’ synthesis of DNA. The enzyme has no detectable 3’→5’ proofreading exonuclease activity, but possesses low 5’→3’ exonuclease activity.

Unit Definition: One unit of enzyme catalyses incorporation of 10 nanomoles of deoxyribonucleotides into  acid-insoluble polynucleotide fraction in 30 min at 70°C.

Activity assay: 50 mM Tris-HCl (pH 8.0 at 25°C), 50 mM NaCl, 10 mM MgCl2, 200 μM dATP, 200 μM dCTP, 200 μM dGTP, 50 μM [3H] dTTP, 0,25 mg/ml activated calf thymus DNA.

Storage conditions: -20° C in 50 mM Tris-HCl (pH 8.0 at 25°), 50 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% glycerol and 1% triton X-100.
Quality control: Endo-, exodeoxyribonucleases, ribonucleases free.

Applications:

    Amplifications of DNA fragments by polymerase chain reaction (PCR).
    DNA labelling with radionucleotides, digoxygenin or biotin.
    DNA sequencing.

 T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Highlights

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications
Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA
 

M-MLV Reverse Transcriptase (RNase H Minus)

Description: Purified from E. coli strain carrying a plasmid with the cloned portion of the pol gene encoding Moloney Murine Leukemia Virus Reverse Transcriptase. The enzyme possesses RNA- and DNA-dependent DNA polymerase activity, but lacks ribonuclease H activity.

Unit definition: One unit is the amount of the enzyme incorporating 1 nmol of dTTP into acid-insoluble form in 10 min at 37ºС in 50 mM Tris-HCl, pH 8.3, 40 mM KCl, 1 mM DTT, 6 mM MgCl2, poly A 2 A260/ml, 2 mM d(pT)12, 50 mM [H3]dTTP, 100 mg/ml BSA.

Storage conditions: 50 mM Tris-HCl, pH 8.0 (at 25 ºС), 100 mM NaCl, 1 mМ EDTA, 5 mМ DTT, 50 % glycerol, 0,1 % NP-40.
Store at –20 °C.
Quality control: Tested for the absence of exo-, endodeoxyribonuclease and ribonuclease activity. 

Applications:
v Production of templates for PCR
v First strand cDNA synthesis
v Construction of cDNA libraries
v Labeling and filling-in 3’-end-termini
v mRNA 5’-end mapping by primer extension analysis
v RNA and DNA sequencing

T4 DNA Ligase catalyzes the formation of a phosphodiester bonds between 5’ phosphate and 3’ hydroxyl termini in duplex DNA/RNA. This enzyme can join-blunt end and cohesive-end termini, repair single stranded nicks in duplexDNA, RNA or DNA/RNA hybrids.Purified from E. coli strain harbouring the plasmid that directs the synthesis of T4 DNA ligase.

Application
Cloning of restriction fragments, joining linkers and adapters to blunt-ended DNA, gene (gene fragments) synthesis.

Ligation
For most cohesive-end ligations, a 30 minute incubation at 20°C is sufficient. Incubations at 16°C for 4-16 hours are routinely used for the majority of applications.

Ligation of blunt-ends and single-base pair overhang fragments requires more enzyme to achieve the same extent of ligation as cohesive-end DNA fragments. Ligation can be enhanced by addition of PEG or by reducing the rATP concentration.

QC

Each lot of T4 DNA ligase is tested for endonucleases/exonucleases, in a blue/white cloning assay.
 

T4 Polynucleotide Kinase catalyses transfer and exchange of Pi from g position of ATP to 5’-hydroxyl terminus of polynucleotides (double and single-stranded DNA and RNA) and nucleoside 3’-monophosphates. Polynucleotide kinase also catalyses the removal of 3’-phosphoryl groups from 3’-phosphoryl polynucleotides and  deoxynucleoside 3’-diphosphates.

Purified from E.coli strain carrying T4 polynucleotide kinase overproducing plasmid.
Quality control: Endo-, exodeoxyribonucleases, ribonucleases, phosphatase free.

Applications:

    DNA or RNA 5'-end labelling.
    Incorporation of  phosphates in 5'-hydroxyle of oligonucleotides to allow subsequent ligation.
    Removal of 3’-phosphoryl group.

E. coli uracil-DNA glycosylase catalyzes the release of free uracil from uracilcontaining DNA.
Uracil-DNA Glycosylase efficiently hydrolyzes uracil from single-stranded or double-stranded DNA, but not
from oligomers (6 or less bases).

Our  DNA Ladders are ideal for determining the size of double-stranded DNA from 50 to 10,000 base pairs.

Our highly purified dNTPs allow for synthesis of DNA PCR-products up to 20 kb.

 
MasterMixes

We offer a variety of PCR MasterMixes from BioLabMix Ltd (http://www.biolabmix.ru/en/):

- MasterMixes for Reverse Trascription,
- Standard PCR,
- Real-Time PCR,
- Hot Start PCR,
- Long Range PCR
 

Reverse transcription
M-MuLV–RH First Strand cDNA Synthesis Kit is a complete system for efficient synthesis of first strand cDNA from mRNA or total RNA templates. The kit includes M-MuLV Reverse Transcriptase lacking RNase H activity. Universal kit for synthesis of first strand cDNA from mRNA or total RNA templates up to 10 kb.

Master-mix for Real-Time PCR 

Ready-to-use solutions optimized for quantitative real-time PCR assay with sequence-specific probes and intercalating dye SYBR Green I. The master mixes include highly processive recombinant Taq DNA Polymerase and dNTPs in an optimized PCR buffer. Only template and primers should be added.
• Specificity – the optimized buffer reduces non-specific amplification and formation of primer dimers risks
• Sensitivity – detects low copy number targets
• Wide linear range – accurate quantification beginning from 10 – 100 copy of target molecules.
• Reproducibility and convenience – ready-to-use 2× master mix

Master-mix for Real-Time RT-PCR and RT-qPCR 

Ready-to-use master mixes for one-step RT-PCR from different RNA templates. They include all the components required for a rapid, sensitive and reproducible RT-PCR (except for RNA template and primers)
• RT and PCR steps are performed in one tube – convenient in use plus reduced contamination risk
• The enzymes are highly sensitive in a broad dynamic range – accurate detection of RNA input (from 1 pg to 1 μg)
• Wide working temperature range (37 to 50 °C) for success with GC-rich and other difficult templates
• RT-PCR products can be loaded directly onto an electrophoresis gel (additional dyes available with BioMaster RT-PCR-Color)
• An inert blue dye eases the pipetting and application of reaction mixtures (BioMaster RT-qPCR SYBR Green

Master-mix for Real-Time Standard PCR 

Conventional PCR
Taq DNA Polymerase is a highly thermostable DNA polymerase from the thermophilic bacterium Thermus aquaticus. Recombinant Taq DNA Polymerase is the ideal tool for standard PCR of 5 kb and shorter template
• Thermostable – half-life is more than 40 min at 95 °C
• Generates PCR products with 3’-dA overhangs
• Incorporates modified nucleotides
• Ready-to-use master mixes (2×) are convenient in use and reduce contamination risk

Contact information:
Biosan/BioLabMix Ltd
28, Injenernaya Str., Novosibirsk NSO 630090 Russia
mail@biosan-nsk.ru, sales@biolabmix.ru
+7 (383) 363 51 91 / +7 (383) 363 51 91
http://www.biosan-nsk.ru
http://www.biolabmix.ru

More Less

Product category: DNA diagnosis kits

Comprehensive diagnostics of parasitic diseases

Opisthorchiasis is a chronic helminthic infection caused by parasitic infestation of the host organism with flatworms of the family Opisthorchiidae.   Opisthorchiasis is often related to the following diseases: purulent cholangitis, acute pancreatitis, cholelithiasis, liver abscess and other diseases. According to WHO data, opisthorchidoses are precancerous conditions, and their agents are assigned to carcinogens of group 1 according to the IARC classification. That is why we developed a line of reagent kits intended for comprehensive diagnosing of opisthorchiasis:

The reagent kit "InVitroLogic Opisthorchis-AB" for immunoassay identification of common antibodies against Opisthorchis felineus in serum and plasma obtained from human blood.   

The reagent kit "InVitroLogic DNA Opisthorchis" helps to discover Opisthorchis felineus, Clonorchis sinensis, Opisthorchis viverrini, Metorchis bilis DNAs in human feces. The test is based on a multiplex polymerase chain reaction with real-time detection of fluorescent signals (real-time PCR).

Products have developed with financial support of Ministry of Education and Science of Russian Federation.

Contact information:
Medical biological Union LLC
16 Inzhenernaya Str.,
Novosibirsk, 630090 Russia
Phone: +7 383 3637714
E-mail: info@mbunion.com

More Less

Product category: Gene tests / molecular biological diagnostic

Colon Cancer Epigenetic PCR detection kit

【INTENDED USE】
This kit is to detect early colon cancer epigenetic changes in DNA. This kit uses GLAD-PCR-Assay method for detection of methylation status of regulatory region in colon cancer specific genes. Kit includes reagents for DNA extraction from the blood sample.
The result is for information purposes only, should not be a basis of making a final diagnosis or for discarding cases.

【PRINCIPLE】
This kit includes DNA extraction kit, GlaI methyl-directed DNA endonuclease, DNA Ligase, gene specific primers, specific fluorescence probe, PCR reaction solution, Hot start DNA polymerase (Hot start Taq DNA polymerase), dNTP mixes. The changes in methylation status are to be detected by in vitro PCR amplification.

【PERFORMANCE CHARACTERISTICS】
Sensitivity: 20 methylated molecules per sample
Linear Range: 20 to 2 x 106 copies per sample
Quantity: 48 tests per kit
Shelf life: 12 months
Storage and Transportation: Stable at -10°C during transportation,
must be stored at -20±2°C upon receipt.

EpiGene Ltd.
info@epigene.ru

More Less

Product category: Immuno assay systems

Probiotic products

ZAO Vektor-BiAlgam is one of the leading companies working in the field of developing and producing pharmaceutical immunobiological preparations, probiotic products, technologies and cultures for the dairy product industry.

Several lines of production are currently under way:

•           Biologically active food supplements: "Ekoflor", "Bifidum BAG", "Trilakt";
•           Biobased product: "Narilak-Forte-B";
•           The "Bifidom" series of cultured probiotic dairy products;
•           Technologies and cultures for the dairy product industry, probiotic cultures consumption in the home ;
•           The "Astera" biomass of probiotic microorganisms for use in the food industry in the production of probiotic products;
•           Liquid lysates of probiotic bacteria for the cosmetic and food industries.

Our unique probiotic complex comprising "Bifidium BAG", "Trilakt" and "Ekoflor" has been developed solely by our scientists at ZAO Vektor BiAlgam. The creation of this complex involved using the latest breakthroughs in the field of microbiology and biotechnology. It can be used in various areas of medicine as a prophylactic and as a combination treatment for a large number of illnesses.

Ekoflor is an innovative combination preparation containing a mixture of highly effective strains of bifidobacteria and lactic acid bacteria that have been fixed in an ultraselective carbon-mineral sorbent.

Trilakt is a potent balanced complex of active lactic acid bacteria that possess multifaceted healing benefits.

Bifidum BAG is an active and potent preparation containing a unique complex of bifidobacteria.
 
Powerful cleansing effect
Complex restoration of microflora
Improved liver function
Possesses antibacterial properties
Powerful immunostimulant
A natural biosorbent
Provides the basis for a healthy microflora
Suitable for newborns
Highly effective correction of normal flora

Contact information:
ZAO Vektor-BiAlgam
Building 104,
Vector GNTs VB Industrial Facilities, Koltsovo, Novosibirsk District,
Novosibirsk Oblast, 630559
Tel/Fax: (383) 336-51-51, 336-75-50
E-mail biomarket@bialgam.ru
www.bialgam.ru

More Less

About us

Company details

Innovative cluster of Novosibirsk region to customers and partners services for business development in Russia and CIS region.

The Territorial Innovations Cluster is a historically established and continuously developing complex of interrelated enterprises and organizations, with advanced scientific, technological, educational, and entrepreneurial competencies, enabling the industries of the new economy to be effectively developed.

The pilot Territorial Innovations Cluster of Information and Biopharmaceutical Technologies has been established in the territory of the Novosibirsk region, which has united two historically formed clusters of respective areas under a single program of government support, which are located in Novosibirsk Academgorodok, the science town of Koltsovo, and the satellite town of Berdsk. 

More Less

Company data

Export content

max. 25%

Number of employees

50-99

Area of business

Diagnostics